Быстрый заказ

Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human AFF4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC063007
Размер кДНК:1062bp
Описание кДНК:Full length Clone DNA of Homo sapiens AF4/FMR2 family, member 4 DNA.
Синоним гена:MCEF, AF5Q31
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15257-ACGRBS15400
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15257-ACRRBS15400
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15257-ANGRBS15400
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15257-ANRRBS15400
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15257-CFRBS13340
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15257-CHRBS13340
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15257-CMRBS13340
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15257-CYRBS13340
Человек AFF4 Джин клон кДНК в вектор клонированияHG15257-GRBS5130
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15257-NFRBS13340
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15257-NHRBS13340
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15257-NMRBS13340
Человек AFF4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15257-NYRBS13340
Человек AFF4 Джин ORF экспрессии кДНК клона плазмидыHG15257-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15257-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».