Быстрый заказ

Text Size:AAA

Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ADPRHL2 Информация о продукте «Клон cDNA»
Размер кДНК:1092bp
Описание кДНК:Full length Clone DNA of Homo sapiens ADP-ribosylhydrolase like 2 with C terminal His tag.
Синоним гена:ARH3, FLJ20446, ADPRHL2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13385-ACGRBS15396
Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13385-ACRRBS15396
Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13385-ANGRBS15396
Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13385-ANRRBS15396
Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13385-CFRBS13343
Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13385-CHRBS13343
Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13385-CMRBS13343
Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13385-CYRBS13343
Человек ARH3 Джин клон кДНК в вектор клонированияHG13385-GRBS5132
Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13385-NFRBS13343
Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13385-NHRBS13343
Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13385-NMRBS13343
Человек ARH3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13385-NYRBS13343
Человек ARH3 Джин ORF экспрессии кДНК клона плазмидыHG13385-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13385-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.