Быстрый заказ

Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ADORA2A Информация о продукте «Клон cDNA»
Размер кДНК:1239bp
Описание кДНК:Full length Clone DNA of Homo sapiens adenosine A2a receptor with N terminal His tag.
Синоним гена:RDC8, hA2aR, ADORA2, ADORA2A
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12307-ACGRBS15396
Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12307-ACRRBS15396
Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12307-ANGRBS15396
Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12307-CFRBS13343
Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12307-CHRBS13343
Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12307-CMRBS13343
Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12307-CYRBS13343
Человек Adenosine Receptor A2a Джин клон кДНК в вектор клонированияHG12307-GRBS5132
Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12307-NFRBS13343
Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12307-NHRBS13343
Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12307-NMRBS13343
Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12307-NYRBS13343
Человек Adenosine Receptor A2a Джин ORF экспрессии кДНК клона плазмидыHG12307-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12307-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие4-5 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.