Быстрый заказ

Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ADNP Информация о продукте «Клон cDNA»
Размер кДНК:3309bp
Описание кДНК:Full length Clone DNA of Homo sapiens activity-dependent neuroprotector homeobox with C terminal His tag.
Синоним гена:ADNP1, KIAA0784, ADNP
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11106-ACGRBS22238
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11106-ACRRBS22238
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11106-ANGRBS22238
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11106-ANRRBS22238
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11106-CFRBS20185
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11106-CHRBS20185
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11106-CMRBS20185
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11106-CYRBS20185
Человек activity-dependent neuroprotector homeobox Джин клон кДНК в вектор клонированияHG11106-MRBS5132
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11106-NFRBS20185
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11106-NHRBS20185
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11106-NMRBS20185
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11106-NYRBS20185
Человек activity-dependent neuroprotector homeobox Джин ORF экспрессии кДНК клона плазмидыHG11106-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11106-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.