After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ADM Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001124.1
Размер кДНК:558bp
Описание кДНК:Full length Clone DNA of Homo sapiens adrenomedullin with C terminal Flag tag.
Синоним гена:AM, ADM
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11646-ACGRBS15400
Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11646-ACRRBS15400
Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11646-CFRBS13340
Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11646-CHRBS13340
Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11646-CMRBS13340
Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11646-CYRBS13340
Человек Adrenomedullin / ADM Джин клон кДНК в вектор клонированияHG11646-MRBS5130
Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11646-NFRBS13340
Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11646-NHRBS13340
Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11646-NMRBS13340
Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11646-NYRBS13340
Человек Adrenomedullin / ADM Джин ORF экспрессии кДНК клона плазмидыHG11646-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Adrenomedullin consists of 52 amino acids and is a member of the adrenomedullin family. It s a a hypotensive peptide and has 1 intramolecular disulfide bond. It seems that adrenomedullin has a slight homology with the calcitonin gene-related peptide. Adrenomedullin has a highly expression in pheochromocytoma and adrenal medulla. It also can be detected in lung, ventricle and kidney tissues. Adrenomedullin and PAMP are potent hypotensive and vasodilatator agents. Numerous actions have been reported most related to the physiologic control of fluid and electrolyte homeostasis. In the kidney, adrenomedullin is diuretic and natriuretic, and both adrenomedullin and PAMP inhibit aldosterone secretion by direct adrenal actions. In pituitary gland, both peptides at physiologically relevant doses inhibit basal ACTH secretion. Both peptides appear to act in brain and pituitary gland to facilitate the loss of plasma volume, actions which complement their hypotensive effects in blood vessels. It is believed that adrenomedullin functions through combinations of the calcitonin receptor like receptor and receptor activity-modifying proteins complexes, as well as CGRP receptors.

Ссылки
  • Hao SL, et al. (2011) The antifibrosis effect of adrenomedullin in human lung fibroblasts. Exp Lung Res. 37(10):615-26.
  • Hikosaka T, et al. (2011) Adrenomedullin production is increased in colorectal adenocarcinomas; its relation to matrix metalloproteinase-9. Peptides. 32(9):1825-31.
  • Boc-Zalewska A, et al. (2011) Adrenomedullin mRNA expression in placenta of preeclamptic women. Ginekol Pol. 82(8):585-91.
  • Palladini G, et al. (2011) Midregional proadrenomedullin (MR-proADM) is a powerful predictor of early death in AL amyloidosis. Amyloid. 18(4):216-21.
  • Size / Price
    Каталог: HG11646-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».