Быстрый заказ

Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ADIPOR2 Информация о продукте «Клон cDNA»
    Размер кДНК:1161bp
    Описание кДНК:Full length Clone DNA of Homo sapiens adiponectin receptor 2 with C terminal His tag.
    Синоним гена:PAQR2, ACDCR2
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with ADIPOR2 qPCR primers for gene expression analysis, HP103800 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15173-ACGRBS15400
    Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15173-ACRRBS15400
    Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15173-CFRBS13340
    Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15173-CHRBS13340
    Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15173-CMRBS13340
    Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15173-CYRBS13340
    Человек Adiponectin Receptor 2 Джин клон кДНК в вектор клонированияHG15173-GRBS5130
    Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15173-NFRBS13340
    Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15173-NHRBS13340
    Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15173-NMRBS13340
    Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15173-NYRBS13340
    Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмидыHG15173-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15173-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.