Быстрый заказ

Text Size:AAA

Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ADIPOR2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC051858
Размер кДНК:1161bp
Описание кДНК:Full length Clone DNA of Homo sapiens adiponectin receptor 2 with C terminal HA tag.
Синоним гена:PAQR2, ACDCR2
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15173-ACGRBS15400
Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15173-ACRRBS15400
Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15173-CFRBS13340
Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15173-CHRBS13340
Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15173-CMRBS13340
Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15173-CYRBS13340
Человек Adiponectin Receptor 2 Джин клон кДНК в вектор клонированияHG15173-GRBS5130
Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15173-NFRBS13340
Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15173-NHRBS13340
Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15173-NMRBS13340
Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15173-NYRBS13340
Человек Adiponectin Receptor 2 Джин ORF экспрессии кДНК клона плазмидыHG15173-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15173-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».