Быстрый заказ

Человек ADCK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ADCK1 Информация о продукте «Клон cDNA»
    Размер кДНК:1571bp
    Описание кДНК:Full length Clone DNA of Homo sapiens aarF domain containing kinase 1 with N terminal Myc tag.
    Синоним гена:FLJ39600
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with ADCK1 qPCR primers for gene expression analysis, HP100706 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек ADCK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек ADCK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10792-ACGRBS16760
    Человек ADCK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10792-ACRRBS16760
    Человек ADCK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10792-CFRBS14710
    Человек ADCK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10792-CHRBS14710
    Человек ADCK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10792-CMRBS14710
    Человек ADCK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10792-CYRBS14710
    Человек ADCK1 Джин клон кДНК в вектор клонированияHG10792-GRBS5130
    Человек ADCK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10792-NFRBS14710
    Человек ADCK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10792-NHRBS14710
    Человек ADCK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10792-NMRBS14710
    Человек ADCK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10792-NYRBS14710
    Человек ADCK1 Джин ORF экспрессии кДНК клона плазмидыHG10792-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG10792-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.