ADAP1/centaurin-alpha cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

ADAP1/centaurin-alpha cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1125 bp
Description
Full length Clone DNA of Human ArfGAP with dual PH domains 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ADAP1/centaurin-alpha cDNA ORF Clone, Human, N-His tag: Alternative Names

CENTA1 cDNA ORF Clone, Human; GCS1L cDNA ORF Clone, Human; p42IP4 cDNA ORF Clone, Human

ADAP1/centaurin-alpha Background Information

Add to Cart Successfully Add to Cart Failed