Быстрый заказ

Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ADAMTS10 Информация о продукте «Клон cDNA»
Размер кДНК:3312bp
Описание кДНК:Full length Clone DNA of Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 10 with C terminal His tag.
Синоним гена:WMS, WMS1, ADAM-TS10, ADAMTS10
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13409-ACGRBS22240
Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13409-ACRRBS22240
Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13409-CFRBS20190
Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13409-CHRBS20190
Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13409-CMRBS20190
Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13409-CYRBS20190
Человек ADAMTS10 Джин клон кДНК в вектор клонированияHG13409-GRBS5130
Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13409-NFRBS20190
Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13409-NHRBS20190
Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13409-NMRBS20190
Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13409-NYRBS20190
Человек ADAMTS10 Джин ORF экспрессии кДНК клона плазмидыHG13409-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13409-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.