After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ADAMTS1 Информация о продукте «Клон cDNA»
Размер кДНК:2904bp
Описание кДНК:Full length Clone DNA of Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 1 with C terminal HA tag.
Синоним гена:C3-C5, METH1, KIAA1346, ADAMTS1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10493-ACGRBS22240
Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10493-ACRRBS22240
Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10493-CFRBS20190
Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10493-CHRBS20190
Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10493-CMRBS20190
Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10493-CYRBS20190
Человек ADAMTS1 Джин клон кДНК в вектор клонированияHG10493-MRBS5130
Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10493-M-FRBS20190
Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10493-NFRBS20190
Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10493-NHRBS20190
Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10493-NMRBS20190
Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10493-NYRBS20190
Человек ADAMTS1 Джин ORF экспрессии кДНК клона плазмидыHG10493-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10493-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.