Быстрый заказ

Человек ADAM15 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ADAM15 Информация о продукте «Клон cDNA»
    Размер кДНК:2319bp
    Описание кДНК:Full length Clone DNA of Homo sapiens ADAM metallopeptidase domain 15 with N terminal HA tag.
    Синоним гена:MDC15
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with ADAM15 qPCR primers for gene expression analysis, HP100023 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек ADAM15 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Человек ADAM15 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10517-ACGRBS16760
    Человек ADAM15 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10517-ACRRBS16760
    Человек ADAM15 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10517-CFRBS14710
    Человек ADAM15 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10517-CHRBS14710
    Человек ADAM15 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10517-CMRBS14710
    Человек ADAM15 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10517-CYRBS14710
    Человек ADAM15 Джин клон кДНК в вектор клонированияHG10517-MRBS5130
    Человек ADAM15 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10517-NFRBS14710
    Человек ADAM15 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10517-NHRBS14710
    Человек ADAM15 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10517-NMRBS14710
    Человек ADAM15 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10517-NYRBS14710
    Человек ADAM15 Джин ORF экспрессии кДНК клона плазмидыHG10517-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    ADAM15, also known as Metargidin, is a type I transmembrane glycoprotein belonging to the ADAM (A Disintegrin and Metalloprotease Domain) family of proteins and is widely expressed in different tissues and cell types. Members of this family contain an amino-terminal metalloprotease domain followed by a disintegrin domain, a cysteine-rich region and a membrane proximal EGF-like domain. The disintegrin domain of ADAM15/metargidin contains an RGD tripeptide sequence, suggesting that it may potentially interact with the integrin family of proteins. ADAM15 is a transmembrane multi-domain proteins implicated in proteolysis, cell-cell and cell-matrix interactions in various disease conditions. There is also evidence supporting a role for ADAM15 in angiogenesis and angioinvasion of tumor cells, which are critical for unrestrained tumor growth and metastatic spread. Given its diverse functions, ADAM15 may represent a pivotal regulatory component of tumor progression, an important target for therapeutic intervention, or emerge as a biomarker of disease progression.

  • Poghosyan Z, et al. (2002) Phosphorylation-dependent interactions between ADAM15 cytoplasmic domain and Src family protein-tyrosine kinases. J Biol Chem. 277(7): 4999-5007.
  • Carl-McGrath S, et al. (2005) The disintegrin-metalloproteinases ADAM9, ADAM12, and ADAM15 are upregulated in gastric cancer. Int J Oncol. 26(1): 17-24.
  • Najy AJ, et al. (2008) ADAM15 supports prostate cancer metastasis by modulating tumor cell-endothelial cell interaction. Cancer Res. 68(4): 1092-9.
  • Maretzky T, et al. (2009) Characterization of the catalytic activity of the membrane-anchored metalloproteinase ADAM15 in cell-based assays. Biochem J. 420(1): 105-13.
  • Size / Price
    Каталог: HG10517-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.