Быстрый заказ

Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACY1 Информация о продукте «Клон cDNA»
Размер кДНК:1227bp
Описание кДНК:Full length Clone DNA of Homo sapiens aminoacylase 1 with N terminal Flag tag.
Синоним гена:ACY1D, ACYLASE
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10549-ACGRBS15396
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10549-ACRRBS15396
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10549-ANGRBS15396
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10549-ANRRBS15396
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10549-CFRBS13343
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10549-CHRBS13343
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10549-CMRBS13343
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10549-CYRBS13343
Человек Aminoacylase-1/ACY1 Джин клон кДНК в вектор клонированияHG10549-MRBS5132
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10549-M-FRBS13343
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10549-NFRBS13343
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10549-NHRBS13343
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10549-NMRBS13343
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10549-NYRBS13343
Человек Aminoacylase-1/ACY1 Джин ORF экспрессии кДНК клона плазмидыHG10549-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Aminoacylase 1 (ACY1), a metalloenzyme that removes amide-linked ACY1 groups from amino acids and may play a role in regulating responses to oxidative stress. Both the C-terminal fragment found in the two-hybrid screen and full-length ACY1 co-immunoprecipitate with SphK1. Though both C-terminal and full-length proteins slightly reduce SphK1 activity measured in vitro, the C-terminal fragment inhibits while full-length ACY1 potentiates the effects of SphK1 on proliferation and apoptosis. It suggested that ACY1 physically interacts with SphK1 and may influence its physiological functions. As a homodimeric zinc-binding enzyme, Aminoacylase 1 catalyzes the hydrolysis of N alpha-acylated amino acids. Deficiency of Aminoacylase 1 due to mutations in the Aminoacylase 1 (ACY1) gene follows an autosomal-recessive trait of inheritance and is characterized by accumulation of N-acetyl amino acids in the urine.

  • Sommer A, et al. (2011) The molecular basis of aminoacylase 1 deficiency. Biochim Biophys Acta. 1812(6): 685-90.
  • Maceyka M, et al. (2004) Aminoacylase 1 is a sphingosine kinase 1-interacting protein. FEBS Lett. 568(1-3): 30-4.
  • Cook RM, et al.(1993) Human aminoacylase-1. Cloning, sequence, and expression analysis of a chromosome 3p21 gene inactivated in small cell lung cancer. J Biol Chem. 268(23): 17010-7.
  • Size / Price
    Каталог: HG10549-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.