After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACTR8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC032744
Размер кДНК:990bp
Описание кДНК:Full length Clone DNA of Homo sapiens ARP8 actin-related protein 8 homolog (yeast) with N terminal HA tag.
Синоним гена:ARP8, hArp8, INO80N, ACTR8
Виды:Human
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14035-ACGRBS15400
Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14035-ACRRBS15400
Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14035-ANGRBS15400
Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14035-ANRRBS15400
Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14035-CFRBS13340
Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14035-CHRBS13340
Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14035-CMRBS13340
Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14035-CYRBS13340
Человек Arp8 Джин клон кДНК в вектор клонированияHG14035-GRBS5130
Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14035-NFRBS13340
Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14035-NHRBS13340
Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14035-NMRBS13340
Человек Arp8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14035-NYRBS13340
Человек Arp8 Джин ORF экспрессии кДНК клона плазмидыHG14035-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14035-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».