Arp6 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

Arp6 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1191 bp
Description
Full length Clone DNA of Human ARP6 actin-related protein 6 homolog (yeast) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Arp6 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

ARP6 cDNA ORF Clone, Human; CDA12 cDNA ORF Clone, Human; hARP6 cDNA ORF Clone, Human; hARPX cDNA ORF Clone, Human; HSPC281 cDNA ORF Clone, Human; MSTP136 cDNA ORF Clone, Human

Arp6 Background Information

Full Name
ARP6 actin-related protein 6 homolog (yeast)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait