actin-related protein 10 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11099-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All actin-related protein 10 Reagents

CRO Services

Product recommended


All actin-related protein 10 Reagents

actin-related protein 10 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1254 bp
Description
Full length Clone DNA of Human actin-related protein 10 homolog (S. cerevisiae) with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

actin-related protein 10 cDNA ORF Clone, Human, C-Myc tag Alternative Names

ACTR11 cDNA ORF Clone, Human;Arp11 cDNA ORF Clone, Human;HARP11 cDNA ORF Clone, Human

actin-related protein 10 Background Information

Full Name
actin-related protein 10 homolog (S. cerevisiae)

actin-related protein 10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
actin-related protein 10 cDNA ORF Clone in Cloning Vector, Rat RG81178-U
actin-related protein 10 cDNA ORF Clone, Rat, untagged RG81178-UT
actin-related protein 10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81178-ACGLN
actin-related protein 10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81178-ACG
actin-related protein 10 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81178-ANG
actin-related protein 10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81178-ACR
actin-related protein 10 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81178-ANR
actin-related protein 10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81178-CF
actin-related protein 10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81178-NF
actin-related protein 10 cDNA ORF Clone, Rat, C-His tag RG81178-CH
actin-related protein 10 cDNA ORF Clone, Rat, N-His tag RG81178-NH
actin-related protein 10 cDNA ORF Clone, Rat, C-HA tag RG81178-CY
actin-related protein 10 cDNA ORF Clone, Rat, N-HA tag RG81178-NY
actin-related protein 10 cDNA ORF Clone, Rat, C-Myc tag RG81178-CM
actin-related protein 10 cDNA ORF Clone, Rat, N-Myc tag RG81178-NM
actin-related protein 10 qPCR Primer Pairs, Rat RP301134

actin-related protein 10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
actin-related protein 10 cDNA ORF Clone in Cloning Vector, Mouse MG51792-U
actin-related protein 10 cDNA ORF Clone, Mouse, untagged MG51792-UT
actin-related protein 10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51792-ACGLN
actin-related protein 10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51792-ACG
actin-related protein 10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51792-ANG
actin-related protein 10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51792-ACR
actin-related protein 10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51792-ANR
actin-related protein 10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51792-CF
actin-related protein 10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51792-NF
actin-related protein 10 cDNA ORF Clone, Mouse, C-His tag MG51792-CH
actin-related protein 10 cDNA ORF Clone, Mouse, N-His tag MG51792-NH
actin-related protein 10 cDNA ORF Clone, Mouse, C-HA tag MG51792-CY
actin-related protein 10 cDNA ORF Clone, Mouse, N-HA tag MG51792-NY
actin-related protein 10 cDNA ORF Clone, Mouse, C-Myc tag MG51792-CM
actin-related protein 10 cDNA ORF Clone, Mouse, N-Myc tag MG51792-NM
actin-related protein 10 qPCR Primer Pairs, Mouse MP201665

actin-related protein 10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
actin-related protein 10 cDNA ORF Clone in Cloning Vector, Human HG11099-M
actin-related protein 10 cDNA ORF Clone, Human, untagged HG11099-UT
actin-related protein 10 cDNA ORF Clone, Human, C-GFPSpark® tag HG11099-ACG
actin-related protein 10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11099-ACGLN
actin-related protein 10 cDNA ORF Clone, Human, N-GFPSpark® tag HG11099-ANG
actin-related protein 10 cDNA ORF Clone, Human, C-OFPSpark® tag HG11099-ACR
actin-related protein 10 cDNA ORF Clone, Human, N-OFPSpark® tag HG11099-ANR
actin-related protein 10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11099-CF
actin-related protein 10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11099-NF
actin-related protein 10 cDNA ORF Clone, Human, C-His tag HG11099-CH
actin-related protein 10 cDNA ORF Clone, Human, N-His tag HG11099-NH
actin-related protein 10 cDNA ORF Clone, Human, C-HA tag HG11099-CY
actin-related protein 10 cDNA ORF Clone, Human, N-HA tag HG11099-NY
actin-related protein 10 cDNA ORF Clone, Human, N-Myc tag HG11099-NM
actin-related protein 10 qPCR Primer Pairs, Human HP101014
info info
添加购物车成功! 添加购物车失败!