Быстрый заказ

Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек ACTN2 Информация о продукте «Клон cDNA»
Размер кДНК:2685bp
Описание кДНК:Full length Clone DNA of Homo sapiens actinin, alpha 2 with C terminal Flag tag.
Синоним гена:CMD1AA,
Участок рестрикции:KpnI + XbaI (6kb + 2.72kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with ACTN2 qPCR primers for gene expression analysis, HP100846 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ACTN2 Gene Plasmid Map
Human ACTN2 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10972-ACGRBS22240
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10972-ACRRBS22240
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10972-ANGRBS22240
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10972-ANRRBS22240
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10972-CFRBS20190
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10972-CHRBS20190
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10972-CMRBS20190
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10972-CYRBS20190
Человек Alpha-actinin-2/ACTN2 Джин клон кДНК в вектор клонированияHG10972-MRBS5130
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10972-M-MRBS20190
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10972-NFRBS20190
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10972-NHRBS20190
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10972-NMRBS20190
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10972-NYRBS20190
Человек Alpha-actinin-2/ACTN2 Джин ORF экспрессии кДНК клона плазмидыHG10972-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10972-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
  • Human ACTN2 natural ORF mammalian expression plasmid, C-Flag tag
  • Human CDK5 ORF mammalian expression plasmid, C-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.