Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1329 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1017C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human actin-like 6A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI(two restriction sites) + XbaI(6kb+1.22kb+0.12kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Actin-like protein 6A/BAF53a cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

ACTL6 cDNA ORF Clone, Human; Arp4 cDNA ORF Clone, Human; ARPN-BETA cDNA ORF Clone, Human; BAF53A cDNA ORF Clone, Human; INO80K cDNA ORF Clone, Human

Actin-like protein 6A/BAF53a Background Information

Increased Actin-like 6A (ACTL6A) expression has been implicated in the development of diverse cancers and recently associated with the Hippo signaling pathway, which is known to regulate biological properties, including proliferation, tissue regeneration, stem cell biology, as well as tumorigenesis. Here we first show that ACTL6A is upregulated in human gliomas and its expression is associated with glioma patient survival. ACTL6A promotes malignant behaviors of glioma cells in vitro and in orthotopic xenograft model. Moreover, effects of ACTL6A on glioma cells proliferation, migration, and invasion could be mediated by YAP/TAZ. These data indicate that ACTL6A may contribute to cancer progression by stabilizing YAP/TAZ and therefore provide a novel therapeutic target for the treatment of human gliomas. Actl6a knockdown reduced the pluripotency of embryonic stem cells (ESCs), and this reduction could not be rescued by the addition of ATP. The abundance of mitochondrially produced ATP affects stem cell pluripotency via Actl6a-mediated histone acetylation. ACTL6A gene mutation analysis should be considered in patients with intellectual disability, learning disabilities, or developmental language disorder.
Full Name
actin-like 6A
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait