beta-Actin cDNA ORF Clone, Human, C-DDK (Flag®) tag

other Green fluorescent protein / GFP Gene Plasmid Map 5609
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Cat: HG10962-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors
Leave us a message

All beta-Actin Reagents

CRO Services

Product recommended

All beta-Actin Reagents

beta-Actin cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
NM_001101.3
RefSeq ORF Size
1128 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human actin, beta with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.18kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

beta-Actin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

beta-Actin cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5609

beta-Actin cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

BRWS1 cDNA ORF Clone, Human;PS1TP5BP1 cDNA ORF Clone, Human

beta-Actin Background Information

Full Name
actin, beta
Research Areas

beta-Actin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
beta-Actin cDNA ORF Clone in Cloning Vector, Rat RG81089-U
beta-Actin cDNA ORF Clone, Rat, untagged RG81089-UT
beta-Actin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81089-ACGLN
beta-Actin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81089-ACG
beta-Actin cDNA ORF Clone, Rat, N-GFPSpark® tag RG81089-ANG
beta-Actin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81089-ACR
beta-Actin cDNA ORF Clone, Rat, N-OFPSpark® tag RG81089-ANR
beta-Actin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81089-CF
beta-Actin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81089-NF
beta-Actin cDNA ORF Clone, Rat, C-His tag RG81089-CH
beta-Actin cDNA ORF Clone, Rat, N-His tag RG81089-NH
beta-Actin cDNA ORF Clone, Rat, C-HA tag RG81089-CY
beta-Actin cDNA ORF Clone, Rat, N-HA tag RG81089-NY
beta-Actin cDNA ORF Clone, Rat, C-Myc tag RG81089-CM
beta-Actin cDNA ORF Clone, Rat, N-Myc tag RG81089-NM
beta-Actin qPCR Primer Pairs, Rat RP301046

beta-Actin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
beta-Actin cDNA ORF Clone in Cloning Vector, Mouse MG57265-U
beta-Actin cDNA ORF Clone, Mouse, untagged MG57265-UT
beta-Actin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57265-ACG
beta-Actin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57265-ACGLN
beta-Actin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57265-ANG
beta-Actin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57265-ACR
beta-Actin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57265-ANR
beta-Actin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57265-CF
beta-Actin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57265-NF
beta-Actin cDNA ORF Clone, Mouse, C-His tag MG57265-CH
beta-Actin cDNA ORF Clone, Mouse, N-His tag MG57265-NH
beta-Actin cDNA ORF Clone, Mouse, C-HA tag MG57265-CY
beta-Actin cDNA ORF Clone, Mouse, N-HA tag MG57265-NY
beta-Actin cDNA ORF Clone, Mouse, C-Myc tag MG57265-CM
beta-Actin cDNA ORF Clone, Mouse, N-Myc tag MG57265-NM

beta-Actin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
beta-Actin cDNA ORF Clone in Cloning Vector, Human HG10962-M
beta-Actin cDNA ORF Clone, Human, untagged HG10962-UT
beta-Actin cDNA ORF Clone, Human, C-GFPSpark® tag HG10962-ACG
beta-Actin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10962-ACGLN
beta-Actin cDNA ORF Clone, Human, N-GFPSpark® tag HG10962-ANG
beta-Actin cDNA ORF Clone, Human, C-OFPSpark® tag HG10962-ACR
beta-Actin cDNA ORF Clone, Human, N-OFPSpark® tag HG10962-ANR
beta-Actin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10962-NF
beta-Actin cDNA ORF Clone, Human, C-His tag HG10962-CH
beta-Actin cDNA ORF Clone, Human, N-His tag HG10962-NH
beta-Actin cDNA ORF Clone, Human, C-HA tag HG10962-CY
beta-Actin cDNA ORF Clone, Human, N-HA tag HG10962-NY
beta-Actin cDNA ORF Clone, Human, C-Myc tag HG10962-CM
beta-Actin cDNA ORF Clone, Human, N-Myc tag HG10962-NM
beta-Actin qPCR Primer Pairs, Human HP100001
info info
添加购物车成功！ 添加购物车失败！