Быстрый заказ

Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACTB Информация о продукте «Клон cDNA»
Размер кДНК:1128bp
Описание кДНК:Full length Clone DNA of Homo sapiens actin, beta with C terminal Flag tag.
Синоним гена:PS1TP5BP1
Участок рестрикции:KpnI + XbaI (6kb + 1.18kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human ACTB Gene Plasmid Map
Human ACTB Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10962-ACGRBS15400
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10962-ACRRBS15400
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10962-ANGRBS15400
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10962-ANRRBS15400
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10962-CFRBS13340
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10962-CHRBS13340
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10962-CMRBS13340
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10962-CYRBS13340
Человек beta Actin/ACTB Джин клон кДНК в вектор клонированияHG10962-MRBS5130
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмидыHG10962-M-NRBS13340
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10962-NFRBS13340
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10962-NHRBS13340
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10962-NMRBS13340
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10962-NYRBS13340
Человек beta Actin/ACTB Джин ORF экспрессии кДНК клона плазмидыHG10962-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10962-CF
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Human ACTB Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.