Actin cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

Actin cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1134 bp
Description
Full length Clone DNA of Human actin, alpha 1, skeletal muscle with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Actin cDNA ORF Clone, Human, N-Myc tag: Alternative Names

ACTA cDNA ORF Clone, Human; ASMA cDNA ORF Clone, Human; CFTD cDNA ORF Clone, Human; CFTD1 cDNA ORF Clone, Human; CFTDM cDNA ORF Clone, Human; MPFD cDNA ORF Clone, Human; NEM1 cDNA ORF Clone, Human; NEM2 cDNA ORF Clone, Human; NEM3 cDNA ORF Clone, Human

Actin Background Information

Nemaline myopathy (NM) is one of the most common congenital nondystrophic myopathies and is characterized by muscle weakness, often from birth. Mutations in ACTA1 are a frequent cause of NM (ie, NEM3). ACTA1 encodes alpha-actin 1, the main constituent of the sarcomeric thin filament. The mechanisms by which mutations in ACTA1 contribute to muscle weakness in NEM3 are incompletely understood. Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, that clinically severe ACTA1-related myopathy can present with muscle morphological findings suggestive of cytoplasmic body myopathy in the absence of definite nemaline rods. The Asn94Lys mutation in skeletal muscle sarcomeric α-actin may be linked to this histological appearance. 
Full Name
actin, alpha 1, skeletal muscle
Add to Cart Successfully Add to Cart Failed