After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACSM5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC016703
Размер кДНК:627bp
Описание кДНК:Full length Clone DNA of Homo sapiens acyl-CoA synthetase medium-chain family member 5.
Синоним гена:FLJ20581, ACSM5
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14230-ACGRBS15400
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14230-ACRRBS15400
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14230-ANGRBS15400
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14230-ANRRBS15400
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14230-CFRBS13340
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14230-CHRBS13340
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14230-CMRBS13340
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14230-CYRBS13340
Человек ACSM5 Джин клон кДНК в вектор клонированияHG14230-GRBS5130
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14230-NFRBS13340
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14230-NHRBS13340
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14230-NMRBS13340
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14230-NYRBS13340
Человек ACSM5 Джин ORF экспрессии кДНК клона плазмидыHG14230-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14230-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».