Быстрый заказ

Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек ACSL6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_015256.2
Размер кДНК:2169bp
Описание кДНК:Full length Clone DNA of Homo sapiens acyl-CoA synthetase long-chain family member 6 with C terminal His tag.
Синоним гена:ACS2, FACL6, LACS2, LACS5, FLJ16173, KIAA0837
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ACSL6 qPCR primers for gene expression analysis, HP101032 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11118-ACGRBS16760
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11118-ACRRBS16760
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11118-ANGRBS16760
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11118-ANRRBS16760
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11118-CFRBS14710
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11118-CHRBS14710
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11118-CMRBS14710
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11118-CYRBS14710
Человек ACSL6 Джин клон кДНК в вектор клонированияHG11118-MRBS5130
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11118-NFRBS14710
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11118-NHRBS14710
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11118-NMRBS14710
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11118-NYRBS14710
Человек ACSL6 Джин ORF экспрессии кДНК клона плазмидыHG11118-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11118-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».