After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ACPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACPL2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_152282.3
Размер кДНК:1443bp
Описание кДНК:Full length Clone DNA of Homo sapiens acid phosphatase-like 2 with N terminal Flag tag.
Синоним гена:FLJ23751, ACPL2
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек ACPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек ACPL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11243-ACGRBS15400
Человек ACPL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11243-ACRRBS15400
Человек ACPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11243-CFRBS13340
Человек ACPL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11243-CHRBS13340
Человек ACPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11243-CMRBS13340
Человек ACPL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11243-CYRBS13340
Человек ACPL2 Джин клон кДНК в вектор клонированияHG11243-MRBS5130
Человек ACPL2 Джин ORF экспрессии кДНК клона плазмидыHG11243-M-NRBS13340
Человек ACPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11243-NFRBS13340
Человек ACPL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11243-NHRBS13340
Человек ACPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11243-NMRBS13340
Человек ACPL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11243-NYRBS13340
Человек ACPL2 Джин ORF экспрессии кДНК клона плазмидыHG11243-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

acid phosphatase-like protein 2, also known as ACPL2, is a secreted protein which belongs to the histidine acid phosphatase family. A large-scale effort, termed the Secreted Protein Discovery Initiative (SPDI), was undertaken to identify novel secreted and transmembrane proteins. In the first of several approaches, a biological signal sequence trap in yeast cells was utilized to identify cDNA clones encoding putative secreted proteins. A second strategy utilized various algorithms that recognize features such as the hydrophobic properties of signal sequences to identify putative proteins encoded by expressed sequence tags (ESTs) from human cDNA libraries. A third approach surveyed ESTs for protein sequence similarity to a set of known receptors and their ligands with the BLAST algorithm. Finally, both signal-sequence prediction algorithms and BLAST were used to identify single exons of potential genes from within human genomic sequence.

Ссылки
  • Clark HF., et al., 2003, Genome Res. 13: 2265-70.
  • Ota T.et al., 2004, Nat. Genet. 36:40-5.
  • Size / Price
    Каталог: HG11243-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».