After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACP5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001611.3
Размер кДНК:978bp
Описание кДНК:Full length Clone DNA of Homo sapiens acid phosphatase 5, tartrate resistant , transcript variant 4 with N terminal Flag tag.
Синоним гена:TRAP, MGC117378
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10550-ACGRBS15400
Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10550-ACRRBS15400
Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10550-CFRBS13340
Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10550-CHRBS13340
Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10550-CMRBS13340
Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10550-CYRBS13340
Человек TRACP/ACP5 transcript variant 4 Джин клон кДНК в вектор клонированияHG10550-MRBS5130
Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10550-M-FRBS13340
Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10550-NFRBS13340
Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10550-NHRBS13340
Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10550-NMRBS13340
Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10550-NYRBS13340
Человек TRACP/ACP5 transcript variant 4 Джин ORF экспрессии кДНК клона плазмидыHG10550-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tartrate-resistant acid phosphatase (TRACP) or acid phosphatase 5, tartrate resistant (ACP5 or TRAP) is a glycosylated monomeric metalloenzyme expressed in mammals. TRACP is associated with osteoblast migration to bone resorption sites, and, once there, TRACP is believed to initiate osteoblast differentiation, activation, and proliferation. TRACP once considered to be just a histochemical marker of osteoclasts is now recognised to be a molecule of widespread occurrence with functions in both the skeleton and the immune system. Two forms of TRACP circulate in human blood, TRACP 5a derived from macrophages and dendritic cells, and TRACP-5b derived from osteoclasts. Recent data have demonstrated the utility of TRACP-5b as a marker of osteoclast number and bone resorption, and serum TRACP-5a as a marker of inflammatory conditions. TRACP is expressed by osteoclasts, macrophages, dendritic cells and a number of other cell types. It has a critical role in many biological processes including skeletal development, collagen synthesis and degradation, the mineralisation of bone, cytokine production by macrophages and dendritic cells, macrophage recruitment, dendritic cell maturation and a role in the development of Th1 responses.

Ссылки
  • Hayman AR. (2008) Tartrate-resistant acid phosphatase (TRAP) and the osteoclast/immune cell dichotomy. Autoimmunity. 41(3): 218-23.
  • Halleen JM, et al. (2006) Tartrate-resistant acid phosphatase 5b (TRACP 5b) as a marker of bone resorption. Clin Lab. 52(9-10): 499-509.
  • Mochizuki Y. (2006) Bone and bone related biochemical examinations. Bone and collagen related metabolites. Tartrate-resistant acid phosphatase (TRACP). Clin Calcium. 16(6): 948-55.
  • Lamp EC, et al. (2000) Biology of tartrate-resistant acid phosphatase. Leuk Lymphoma. 39(5-6): 477-84.
  • Size / Price
    Каталог: HG10550-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».