After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACOX2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC047700
Размер кДНК:2046bp
Описание кДНК:Full length Clone DNA of Homo sapiens acyl-CoA oxidase 2, branched chain DNA.
Синоним гена:BCOX, BRCOX, THCCox, BRCACOX
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15207-ACGRBS16760
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15207-ACRRBS16760
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15207-ANGRBS16760
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15207-ANRRBS16760
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15207-CFRBS14710
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15207-CHRBS14710
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15207-CMRBS14710
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15207-CYRBS14710
Человек ACOX2 Джин клон кДНК в вектор клонированияHG15207-GRBS5130
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15207-NFRBS14710
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15207-NHRBS14710
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15207-NMRBS14710
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15207-NYRBS14710
Человек ACOX2 Джин ORF экспрессии кДНК клона плазмидыHG15207-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15207-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».