After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACOT9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC012573
Размер кДНК:639bp
Описание кДНК:Full length Clone DNA of Homo sapiens acyl-CoA thioesterase 9.
Синоним гена:CGI-16, ACATE2, MT-ACT48, MTACT48, ACOT9
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14234-ACGRBS15400
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14234-ACRRBS15400
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14234-ANGRBS15400
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14234-ANRRBS15400
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14234-CFRBS13340
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14234-CHRBS13340
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14234-CMRBS13340
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14234-CYRBS13340
Человек Acyl-CoA Thioesterase 9 Джин клон кДНК в вектор клонированияHG14234-GRBS5130
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмидыHG14234-G-NRBS13340
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14234-NFRBS13340
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14234-NHRBS13340
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14234-NMRBS13340
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14234-NYRBS13340
Человек Acyl-CoA Thioesterase 9 Джин ORF экспрессии кДНК клона плазмидыHG14234-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14234-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».