Быстрый заказ

Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACOT11 Информация о продукте «Клон cDNA»
Размер кДНК:666bp
Описание кДНК:Full length Clone DNA of Homo sapiens acyl-CoA thioesterase 11 with C terminal His tag.
Синоним гена:BFIT, THEA, THEM1, STARD14, ACOT11
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14020-ACGRBS15400
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14020-ACRRBS15400
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14020-ANGRBS15400
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14020-ANRRBS15400
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14020-CFRBS13340
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14020-CHRBS13340
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14020-CMRBS13340
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14020-CYRBS13340
Человек ACOT11 Джин клон кДНК в вектор клонированияHG14020-GRBS5130
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14020-NFRBS13340
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14020-NHRBS13340
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14020-NMRBS13340
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14020-NYRBS13340
Человек ACOT11 Джин ORF экспрессии кДНК клона плазмидыHG14020-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14020-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.