Быстрый заказ

Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACE2 Информация о продукте «Клон cDNA»
Размер кДНК:2418bp
Описание кДНК:Full length Clone DNA of Homo sapiens angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 with N terminal His tag.
Синоним гена:ACE2, ACEH, DKFZP434A014
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10108-ACGRBS16760
Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10108-ACRRBS16760
Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10108-CFRBS14710
Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10108-CHRBS14710
Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10108-CMRBS14710
Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10108-CYRBS14710
Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин клон кДНК в вектор клонированияHG10108-MRBS5130
Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10108-NFRBS14710
Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10108-NHRBS14710
Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10108-NMRBS14710
Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10108-NYRBS14710
Человек ACE2 / Angiotensin-Converting Enzyme 2 Джин ORF экспрессии кДНК клона плазмидыHG10108-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by counterbalancing ACE activity. Accumulating evidence in recent years has demonstrated a physiological and pathological role of ACE2 in the cardiovascular, renal and respiratory systems. ACE2 also has an important role in blood pressure control. This enzyme, an homolog of ACE, hydrolyzes angiotensin (Ang) I to produce Ang-(1-9), which is subsequently converted into Ang-(1-7) by a neutral endopeptidase and ACE. ACE2 releases Ang-(1-7) more efficiently than its catalysis of Ang-(1-9) by cleavage of Pro(7)-Phe(8) bound in Ang II. Thus, the major biologically active product of ACE2 is Ang-(1-7), which is considered to be a beneficial peptide of the RAS cascade in the cardiovascular system. A physiological role for ACE2 has been implicated in hypertension, cardiac function, heart function and diabetes, and as a receptor of the severe acute respiratory syndrome coronavirus. In the acute respiratory distress syndrome (ARDS), ACE, AngII, and AT1R promote the disease pathogenesis, whereas ACE2 and the AT2R protect from ARDS. Importantly, ACE2 has been identified as a key SARS-coronavirus receptor and plays a protective role in severe acute respiratory syndrome (SARS) pathogenesis. Furthermore, the recent explosion of research into the ACE2 homolog, collectrin, has revealed a new physiological function of ACE2 as an amino acid transporter, which explains the pathogenic role of gene mutations in Hartnup disorder. This review summarizes and discusses the recently unveiled roles for ACE2 in disease pathogenesis.

  • Koitka A, et al. (2008) Angiotensin converting enzyme 2 in the kidney. Clin Exp Pharmacol Physiol. 35(4): 420-5.
  • Raizada MK, et al. (2007) ACE2: a new target for cardiovascular disease therapeutics. J Cardiovasc Pharmacol. 50(2): 112-9.
  • Imai Y, et al. (2007) Angiotensin-converting enzyme 2 (ACE2) in disease pathogenesis. Circ J. 74(3): 405-10.
  • Turner AJ, et al. (2004) ACE2: from vasopeptidase to SARS virus receptor. Trends Pharmacol Sci. 25(6): 291-4.
  • Size / Price
    Каталог: HG10108-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.