After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACBD6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_032360.2
Размер кДНК:849bp
Описание кДНК:Full length Clone DNA of Homo sapiens acyl-Coenzyme A binding domain containing 6 with C terminal His tag.
Синоним гена:MGC2404, ACBD6
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11112-ACGRBS15396
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11112-ACRRBS15396
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11112-ANGRBS15396
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11112-ANRRBS15396
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11112-CFRBS13343
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11112-CHRBS13343
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11112-CMRBS13343
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11112-CYRBS13343
Человек ACBD6 Джин клон кДНК в вектор клонированияHG11112-MRBS5132
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11112-M-FRBS13343
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11112-NFRBS13343
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11112-NHRBS13343
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11112-NMRBS13343
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11112-NYRBS13343
Человек ACBD6 Джин ORF экспрессии кДНК клона плазмидыHG11112-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Human acyl-coenzyme A binding domain-containing member 6 (ACBD6) is a modular protein that carries an acyl-CoA binding domain at its N terminus and two ankyrin motifs at its C terminus. In mammals, there are six members of the acyl-CoA binding domain-containing (ACBD) family, and their annotation is not uniform. All six ACBD proteins contain an ACB domain at the N terminus, but they do not share significant homology at the C-terminal region. ACBD6 is a 32 kDa protein that is predicted by sequence analysis to carry an ACB domain between residues 42 and 125 and two ANK motifs at its C terminus. This protein binds long-chain acyl-CoAs with a strong preference for unsaturated, C18:1-CoA and C20:4-CoA, over saturated, C16:0-CoA, acyl species. ACBD6 is not a ubiquitous protein, but it is expressed in hematopoietic tissues and appears to be restricted to primitive stem cells present in those tissues with functions in blood and vessel development. ACBD6 was detected in bone marrow, spleen, placenta, cord blood, circulating CD34+ progenitors, and embryonic-like stem cells derived from placenta. In placenta, the protein was only detected in CD34+ progenitor cells present in blood and in CD31+ endothelial cells surrounding the blood vessels. These cells were also positive for the marker CD133, and they probably constitute hemangiogenic stem cells, precursors of both blood and vessels. We propose that human ACBD6 represents a cellular marker for primitive progenitor cells with functions in hematopoiesis and vascular endothelium development.

Ссылки
  • Soupene E, et al. (2008) Characterization of an acyl-coenzyme A binding protein predominantly expressed in human primitive progenitor cells. J Lipid Res. 49(5): 1103-12.
  • Size / Price
    Каталог: HG11112-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».