Быстрый заказ

Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACBD5 Информация о продукте «Клон cDNA»
Размер кДНК:1473bp
Описание кДНК:Full length Clone DNA of Homo sapiens acyl-CoA binding domain containing 5 with N terminal His tag.
Синоним гена:ACBD5
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14861-ACGRBS15396
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14861-ACRRBS15396
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14861-ANGRBS15396
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14861-ANRRBS15396
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14861-CFRBS13343
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14861-CHRBS13343
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14861-CMRBS13343
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14861-CYRBS13343
Человек ACBD5 Джин клон кДНК в вектор клонированияHG14861-GRBS5130
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14861-NFRBS13343
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14861-NHRBS13343
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14861-NMRBS13340
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14861-NYRBS13343
Человек ACBD5 Джин ORF экспрессии кДНК клона плазмидыHG14861-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.