ACAT2 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

ACAT2 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1194 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human acetyl-CoA acetyltransferase 2.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6.1kb+1.19kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ACAT2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACAT2 cDNA ORF Clone, Human, untagged: Validated Images

ACAT2 Background Information

Acyl-coenzyme A: cholesterol acyltransferase (ACAT) is an intracellular enzyme that produces cholesteryl esters in various tissues. In mammals, two ACAT genes (ACAT1 and ACAT2) have been identified. Together, these two enzymes are involved in storing cholesteryl esters as lipid droplets, in macrophage foam-cell formation, in absorbing dietary cholesterol, and in supplying cholesteryl esters as part of the core lipid for lipoprotein synthesis and assembly. The key difference in tissue distribution of ACAT1 and ACAT2 between humans, mice and monkeys is that, in adult human liver (including hepatocytes and bile duct cells), the major enzyme is ACAT1, rather than ACAT2. There is compelling evidence implicating a role for ACAT1 in macrophage foam-cell formation, and for ACAT2 in intestinal cholesterol absorption.Ubiquitin linkage to cysteine is an unconventional modification targeting protein for degradation. However, the physiological regulation of cysteine ubiquitylation is still mysterious. Here we found that ACAT2, a cellular enzyme converting cholesterol and fatty acid to cholesteryl esters, was ubiquitylated on Cys277 for degradation when the lipid level was low. gp78-Insigs catalysed Lys48-linked polyubiquitylation on this Cys277. A high concentration of cholesterol and fatty acid, however, induced cellular reactive oxygen species (ROS) that oxidized Cys277, resulting in ACAT2 stabilization and subsequently elevated cholesteryl esters. Furthermore, ACAT2 knockout mice were more susceptible to high-fat diet-associated insulin resistance. By contrast, expression of a constitutively stable form of ACAT2 (C277A) resulted in higher insulin sensitivity. ACAT2 is an appealing target for therapy to reduce coronary heart disease.
Full Name
acetyl-CoA acetyltransferase 2
Add to Cart Successfully Add to Cart Failed