After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACAP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC018543
Размер кДНК:2223bp
Описание кДНК:Full length Clone DNA of Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 1.
Синоним гена:CENTB1, KIAA0050, ACAP1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14220-ACGRBS16760
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14220-ACRRBS16760
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14220-ANGRBS16760
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14220-ANRRBS16760
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14220-CFRBS14710
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14220-CHRBS14710
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14220-CMRBS14710
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14220-CYRBS14710
Человек ACAP1/CENTB1 Джин клон кДНК в вектор клонированияHG14220-GRBS5130
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14220-NFRBS14710
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14220-NHRBS14710
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14220-NMRBS14710
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14220-NYRBS14710
Человек ACAP1/CENTB1 Джин ORF экспрессии кДНК клона плазмидыHG14220-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14220-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».