Быстрый заказ

Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ACADM Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC005377
Размер кДНК:1266bp
Описание кДНК:Full length Clone DNA of Homo sapiens acyl-CoA dehydrogenase, C-4 to C-12 straight chain with N terminal Myc tag.
Синоним гена:MCAD, ACAD1, MCADH
Виды:Human
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14896-ACGRBS15396
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14896-ACRRBS15396
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14896-ANGRBS15396
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14896-ANRRBS15396
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14896-CFRBS13343
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14896-CHRBS13343
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14896-CMRBS13343
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14896-CYRBS13343
Человек ACADM/MCAD Джин клон кДНК в вектор клонированияHG14896-GRBS5132
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14896-NFRBS13343
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14896-NHRBS13343
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14896-NMRBS13343
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14896-NYRBS13343
Человек ACADM/MCAD Джин ORF экспрессии кДНК клона плазмидыHG14896-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14896-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».