After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human ABL1 natural ORF mammalian expression plasmid

ПаспортОбзорыСвязанные продуктыПротоколы
Human ABL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC_117451.1
Размер кДНК:3450bp
Описание кДНК:Full length Clone DNA of Homo sapiens c-abl oncogene 1, receptor tyrosine kinase.
Синоним гена:ABL, JTK7, p150, c-ABL, v-abl, bcr/abl,
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-ABL1
Участок рестрикции:KpnI (two restriction sites) + XbaI (6.11kb+3.01kb+0.44kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 9 G>A, 12 G>A, 1554 A>G and 3381 A>G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human ABL1 Gene Plasmid Map
Human ABL1 natural ORF mammalian expression plasmid
Product nameProduct name
Фон

c-Abl belongs to the class of tyrosine kinases and is the prototype of a subfamily which includes two members, c-Abl and Arg (Abl-related gene). Both proteins are localized at the cell membrane, actin cytoskeleton and cytosol, and c-Abl is present in the nucleus as well. c-Abl is a non-receptor tyrosine kinase that participates in multiple signaling pathways linking the cell surface, cytoskeleton, and the nucleus. Recent in vitro studies have also linked c-Abl to amyloid-beta-induced toxicity and tau phosphorylation. c-Abl has been implicated in many cellular processes including differentiation, division, adhesion, death, and stress response. c-Abl is a latent tyrosine kinase that becomes activated in response to numerous extra- and intra-cellular stimuli. The c-Abl protein is a ubiquitously expressed nonreceptor tyrosine kinase involved in the development and function of many mammalian organ systems, including the immune system and bone. It regulates the cellular response to TAM through functional interaction with the estrogen receptor, which suggests c-Abl as a therapeutic target and a prognostic tumor marker for breast cancer. c-Abl also plays a key role in signaling chemokine-induced T-cell migration. In addition, c-Abl contains NLSs (nuclear localization signals) and DNA-binding sequences important for nuclear functions. c-Abl has become an important therapeutic target in human chronic myeloid leukaemia.

Ссылки
  • Qiu Z, et al. (2010) c-Abl tyrosine kinase regulates cardiac growth and development. Proc Natl Acad Sci U S A. 107(3): 1136-41.
  • Huang Y, et al. (2008) The c-Abl tyrosine kinase regulates actin remodeling at the immune synapse. Blood. 112(1): 111-9.
  • Sirvent A, et al. (2008) Cytoplasmic signalling by the c-Abl tyrosine kinase in normal and cancer cells. Biol Cell. 100(11): 617-31.
  • Shaul Y, et al. (2005) Role of c-Abl in the DNA damage stress response. Cell Res. 15(1): 33-5.
  • Size / Price
    Каталог: HG11199-UT
    Цена по прейскуранту:   (Save )
    Цена:      [How to order]
    Наличие
     Инструкции по доставке
    Изображения
    • Human ABL1 natural ORF mammalian expression plasmid
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».