After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ABHD5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC021958
Размер кДНК:1050bp
Описание кДНК:Full length Clone DNA of Homo sapiens abhydrolase domain containing 5.
Синоним гена:CGI-58, CDS, CGI58, IECN2, MGC8731, NCIE2, ABHD5
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14216-ACGRBS15396
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14216-ACRRBS15396
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14216-ANGRBS15396
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14216-ANRRBS15396
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14216-CFRBS13343
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14216-CHRBS13343
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14216-CMRBS13343
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14216-CYRBS13343
Человек ABHD5 Джин клон кДНК в вектор клонированияHG14216-GRBS5132
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14216-NFRBS13343
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14216-NHRBS13343
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14216-NMRBS13343
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14216-NYRBS13343
Человек ABHD5 Джин ORF экспрессии кДНК клона плазмидыHG14216-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14216-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».