After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ABHD10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC014516
Размер кДНК:921bp
Описание кДНК:Full length Clone DNA of Homo sapiens abhydrolase domain containing 10 with C terminal Flag tag.
Синоним гена:ABHD10
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14439-ACGRBS15400
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14439-ACRRBS15400
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14439-ANGRBS15400
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14439-ANRRBS15400
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14439-CFRBS13340
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14439-CHRBS13340
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14439-CMRBS13340
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14439-CYRBS13340
Человек ABHD10 Джин клон кДНК в вектор клонированияHG14439-GRBS5130
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14439-NFRBS13340
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14439-NHRBS13340
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14439-NMRBS13340
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14439-NYRBS13340
Человек ABHD10 Джин ORF экспрессии кДНК клона плазмидыHG14439-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Mycophenolic acid (MPA), the active metabolite of the immunosuppressant mycophenolate mofetil (MMF), is primarily metabolized by glucuronidation to a phenolic glucuronide (MPAG) and an acyl glucuronide (AcMPAG). It is known that AcMPAG, which may be an immunotoxic metabolite, is deglucuronidated in human liver. AcMPAG deglucuronidation activity was detected in both human liver cytosol (HLC) and microsomes (HLM). By purification from HLC with column chromatographic purification steps, the enzyme responsible for AcMPAG deglucuronidationis identified as α/β hydrolase domain containing 10 (ABHD10). Recombinant ABHD10 expressed in Sf9 cells efficiently deglucuronidated AcMPAG with a K(m) value of 100.7 ± 10.2 μM, which was similar to those in HLM, HLC, and human liver homogenates (HLH). Immunoblot analysis revealed ABHD10 protein expression in both HLC and HLM. The AcMPAG deglucuronidation by recombinant ABHD10, HLC, and HLH were potently inhibited by AgNO(3), CdCl(2), CuCl(2), PMSF, bis-p-nitrophenylphosphate, and DTNB. The CL(int) value of AcMPAG formation from MPA, which was catalyzed by human UGT2B7, in HLH was increased by 1.8-fold in the presence of PMSF. Thus, human ABHD10 would affect the formation of AcMPAG, the immunotoxic metabolite.

Ссылки
  • Nardini M. et al., 1999, Curr Opin Struct Biol. 9 (6): 732-7.
  • Carr PD. et al., 2009, Protein Pept Lett. 16 (10): 1137-48.
  • Cheah E. et al., 1992, Protein Eng. 5 (3): 197-211.
  • Iwamura A. et al., 2012, J Biol Chem. 287 (12): 9240-9.
  • Size / Price
    Каталог: HG14439-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».