Быстрый заказ

Человек ABCB1 Джин ORF экспрессии кДНК клона плазмиды

  • Human ABCB1 natural ORF mammalian expression plasmid
ПаспортОбзорыСвязанные продуктыПротоколы
Человек ABCB1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000927
Размер кДНК:3843bp
Описание кДНК:Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 1.
Синоним гена:P-gp, CD243, GP170, ABC20
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-ABCB1
Участок рестрикции:KpnI (two restriction sites) + XbaI (6.1kb + 2.82kb + 1.07kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 3435T>C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ABCB1 qPCR primers for gene expression analysis, HP101566 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ABCB1 Gene Plasmid Map
Human ABCB1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Каталог: HG12030-UT
Цена по прейскуранту: 
Цена:      (You Save: )

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».