Быстрый заказ

Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human AACS Информация о продукте «Клон cDNA»
Размер кДНК:2019bp
Описание кДНК:Full length Clone DNA of Homo sapiens acetoacetyl-CoA synthetase with C terminal His tag.
Синоним гена:ACSF1, SUR-5, FLJ12389, FLJ41251, AACS
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11117-ACGRBS16760
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11117-ACRRBS16760
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11117-ANGRBS16760
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11117-ANRRBS16760
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11117-CFRBS14710
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11117-CHRBS14710
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11117-CMRBS14710
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11117-CYRBS14710
Человек Acetoacetyl-CoA Synthetase Джин клон кДНК в вектор клонированияHG11117-MRBS5130
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11117-NFRBS14710
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11117-NHRBS14710
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11117-NMRBS14710
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11117-NYRBS14710
Человек Acetoacetyl-CoA Synthetase Джин ORF экспрессии кДНК клона плазмидыHG11117-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Acetoacetyl-CoA Synthetase (AACS) is a novel cytosolic ketone body (acetoacetate)-specific ligase. The AACS in adipose tissue plays an important role in utilizing ketone body for the fatty acid-synthesis during adipose tissue development. It had been improved that Acetoacetyl-CoA Synthetase is an essential enzyme for the synthesis of fatty acid and cholesterol from ketone bodies, was found to be highly expressed in mouse adipose tissue, and GC box and C/EBPs motif were crucial for AACS promoter activity in 3T3-L1 adipocytes. Moreover, AACS promoter activity was controlled mainly by C/EBPalpha during adipogenesis. AACS gene expression is particularly abundant in white adipose tissue, as it is induced during adipocyte differentiation. The human AACS promoter is a PPARgamma target gene and that this nuclear receptor is recruited to the AACS promoter by direct interaction with Sp1 (stimulating protein-1). The Acetoacetyl-CoA Synthetase has important roles in the regulation of ketone body utilization in rat liver and that these hypocholesterolemic agents have the ability to remedy the impaired utilization of ketone bodies under the diabetic condition.

  • Aguil F, et al. (2010) Transcriptional regulation of the human acetoacetyl-CoA synthetase gene by PPARgamma. Biochem J. 427(2): 255-64.
  • Hasegawa S, et al. (2008) Transcriptional regulation of ketone body-utilizing enzyme, acetoacetyl-CoA synthetase, by C/EBPalpha during adipocyte differentiation. Biochim Biophys Acta. 1779(6-7): 414-9.
  • Sato H, et al. (2002) Effects of streptozotocin-induced diabetes on acetoacetyl-CoA synthetase activity in rats. Biochem Pharmacol. 63(10): 1851-5.
  • Size / Price
    Каталог: HG11117-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.