Быстрый заказ

Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HNRNPK Информация о продукте «Клон cDNA»
Размер кДНК:1392bp
Описание кДНК:Full length Clone DNA of Homo sapiens heterogeneous nuclear ribonucleoprotein K with His tag.
Синоним гена:RP11-575L7.1, CSBP, FLJ41122, HNRPK, TUNP, HNRNPK
Участок рестрикции:KpnI + XhoI (5.5kb + 1.42kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref.ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human HNRNPK Gene Plasmid Map
Human HNRNPK Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14077-ACGRBS15400
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14077-ACRRBS15400
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14077-ANGRBS15400
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14077-ANRRBS15400
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14077-CFRBS13340
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14077-CHRBS13340
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14077-CMRBS13340
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14077-CYRBS13340
Человек HNRNPK Джин клон кДНК в вектор клонированияHG14077-GRBS5130
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14077-NFRBS13340
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14077-NHRBS13340
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14077-NMRBS13340
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14077-NYRBS13340
Человек HNRNPK Джин ORF экспрессии кДНК клона плазмидыHG14077-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14077-G-H
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.