After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human HLA-A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:
Описание кДНК:
Синоним гена:
Виды:Human
переносчик:
Участок рестрикции:
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:
Склад:
Human HLA-A Gene Plasmid Map
Human HLA-A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13263-ACGRBS15400
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13263-ACRRBS15400
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13263-CFRBS13340
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13263-CHRBS13340
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13263-CMRBS13340
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13263-CYRBS13340
Человек HLA-A Джин клон кДНК в вектор клонированияHG13263-GRBS5130
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13263-G-HRBS13340
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13263-NFRBS13340
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13263-NHRBS13340
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13263-NMRBS13340
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13263-NYRBS13340
Человек HLA-A Джин ORF экспрессии кДНК клона плазмидыHG13263-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».