After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HLA-A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:
Описание кДНК:
Синоним гена:
Виды:Human
переносчик:
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Склад:
Human HLA-A Gene Plasmid Map
Human HLA-A Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human HLA-A Gene Expression validated Image
Human HLA-A natural ORF mammalian expression plasmid, Flag tag
[Щелкните, чтобы увеличить изображение]
Caption:
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
pCMV/hygro-FLAG Vector Information
 
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13263-ACGRBS15396
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13263-ACRRBS15396
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13263-CFRBS13343
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13263-CHRBS13343
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13263-CMRBS13343
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13263-CYRBS13343
Человек HLA-A Джин клон кДНК в вектор клонированияHG13263-GRBS5132
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13263-G-HRBS13343
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13263-NFRBS13343
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13263-NHRBS13343
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13263-NMRBS13343
Человек HLA-A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13263-NYRBS13343
Человек HLA-A Джин ORF экспрессии кДНК клона плазмидыHG13263-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Contact Us
Изображения
  • Human HLA-A Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
  • Human HLA-A natural ORF mammalian expression plasmid, Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».