Быстрый заказ

HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    HIV HIV-gag Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:AB731740.1
    Размер кДНК:1566bp
    Описание кДНК:Full length Clone DNA of HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag with C terminal HA tag.
    Синоним гена:HIV-gag
    Виды:HIV
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-HA Метка on other vectors
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-GFPSpark МеткаVG40260-ACGRBS23610
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40260-ACRRBS23610
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-GFPSpark МеткаVG40260-ANGRBS23610
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40260-ANRRBS23610
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-Flag МеткаVG40260-CFRBS21550
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-His МеткаVG40260-CHRBS21550
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-Myc МеткаVG40260-CMRBS21550
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-HA МеткаVG40260-CYRBS21550
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid (Codon Optimized)VG40260-GRBS7870
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-Flag МеткаVG40260-NFRBS21550
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-His МеткаVG40260-NHRBS21550
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-Myc МеткаVG40260-NMRBS21550
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-HA МеткаVG40260-NYRBS21550
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag natural ORF mammalian expression plasmidVG40260-UTRBS21550
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: VG40260-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».