After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
HIV HIV-gag Информация о продукте «Клон cDNA»
Gene_bank_ref_id:GQ324962.1
Размер кДНК:1536bp
Описание кДНК:Full length Clone DNA of HIV-1 (group N, strain 06CM-U14296) gag with C terminal HA tag.
Синоним гена:HIV-gag
Виды:HIV
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-HA Метка on other vectors
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-GFPSpark МеткаVG40254-ACGRBS23610
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40254-ACRRBS23610
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-GFPSpark МеткаVG40254-ANGRBS23610
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40254-ANRRBS23610
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-Flag МеткаVG40254-CFRBS21550
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-His МеткаVG40254-CHRBS21550
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-Myc МеткаVG40254-CMRBS21550
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, C-HA МеткаVG40254-CYRBS21550
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid (Codon Optimized)VG40254-GRBS7870
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-Flag МеткаVG40254-NFRBS21550
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-His МеткаVG40254-NHRBS21550
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-Myc МеткаVG40254-NMRBS21550
HIV-1 (group N, strain 06CM-U14296) gag ORF mammalian expression plasmid, N-HA МеткаVG40254-NYRBS21550
HIV-1 (group N, strain 06CM-U14296) gag natural ORF mammalian expression plasmidVG40254-UTRBS21550
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40254-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».