After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
HIV HIV-rev Информация о продукте «Клон cDNA»
Gene_bank_ref_id:K03455
Размер кДНК:351bp
Описание кДНК:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) rev with N terminal His tag.
Синоним гена:HIV-rev
Виды:HIV
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His Метка on other vectors
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-GFPSpark МеткаVG40247-ACGRBS22240
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40247-ACRRBS22240
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-GFPSpark МеткаVG40247-ANGRBS22240
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40247-ANRRBS22240
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Flag МеткаVG40247-CFRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-His МеткаVG40247-CHRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Myc МеткаVG40247-CMRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-HA МеткаVG40247-CYRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid (Codon Optimized)VG40247-GRBS6500
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Flag МеткаVG40247-NFRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His МеткаVG40247-NHRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Myc МеткаVG40247-NMRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-HA МеткаVG40247-NYRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev natural ORF mammalian expression plasmidVG40247-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40247-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».