Быстрый заказ

HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    HIV HIV-rev Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:K03455
    Размер кДНК:351bp
    Описание кДНК:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) rev with N terminal His tag.
    Синоним гена:HIV-rev
    Виды:HIV
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His Метка on other vectors
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-GFPSpark МеткаVG40247-ACGRBS22240
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40247-ACRRBS22240
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-GFPSpark МеткаVG40247-ANGRBS22240
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40247-ANRRBS22240
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Flag МеткаVG40247-CFRBS20190
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-His МеткаVG40247-CHRBS20190
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Myc МеткаVG40247-CMRBS20190
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-HA МеткаVG40247-CYRBS20190
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid (Codon Optimized)VG40247-GRBS6500
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Flag МеткаVG40247-NFRBS20190
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His МеткаVG40247-NHRBS20190
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Myc МеткаVG40247-NMRBS20190
    HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-HA МеткаVG40247-NYRBS20190
    HIV-1 (group M, subtype B, strain HXB2) rev natural ORF mammalian expression plasmidVG40247-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: VG40247-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».