Быстрый заказ

HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
HIV HIV-rev Информация о продукте «Клон cDNA»
Размер кДНК:351bp
Описание кДНК:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) rev with C terminal HA tag.
Синоним гена:HIV-rev
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-HA Метка on other vectors
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-GFPSpark МеткаVG40247-ACGRBS22240
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40247-ACRRBS22240
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-GFPSpark МеткаVG40247-ANGRBS22240
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40247-ANRRBS22240
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Flag МеткаVG40247-CFRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-His МеткаVG40247-CHRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Myc МеткаVG40247-CMRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-HA МеткаVG40247-CYRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid (Codon Optimized)VG40247-GRBS6500
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Flag МеткаVG40247-NFRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His МеткаVG40247-NHRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Myc МеткаVG40247-NMRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-HA МеткаVG40247-NYRBS20190
HIV-1 (group M, subtype B, strain HXB2) rev natural ORF mammalian expression plasmidVG40247-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40247-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.