Быстрый заказ

HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    HIV HIV-gag Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:K03455
    Размер кДНК:1503bp
    Описание кДНК:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) gag with N terminal His tag.
    Синоним гена:HIV-gag
    Виды:HIV
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His Метка on other vectors
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-GFPSpark МеткаVG40243-ACGRBS23610
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40243-ACRRBS23610
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-GFPSpark МеткаVG40243-ANGRBS23610
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40243-ANRRBS23610
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-Flag МеткаVG40243-CFRBS21550
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-His МеткаVG40243-CHRBS21550
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-Myc МеткаVG40243-CMRBS21550
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-HA МеткаVG40243-CYRBS21550
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid (Codon Optimized)VG40243-GRBS7870
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-Flag МеткаVG40243-NFRBS21550
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His МеткаVG40243-NHRBS21550
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-Myc МеткаVG40243-NMRBS21550
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-HA МеткаVG40243-NYRBS21550
    HIV-1 (group M, subtype B, strain HXB2) gag natural ORF mammalian expression plasmidVG40243-UTRBS21550
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: VG40243-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».