After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
HIV HIV-gag Информация о продукте «Клон cDNA»
Gene_bank_ref_id:U51190.1
Размер кДНК:1500bp
Описание кДНК:Full length Clone DNA of HIV-1 (group M, subtype A, strain 92UG037.1) gag with N terminal His tag.
Синоним гена:HIV-gag
Виды:HIV
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-His Метка on other vectors
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-GFPSpark МеткаVG40241-ACGRBS22240
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40241-ACRRBS22240
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-GFPSpark МеткаVG40241-ANGRBS22240
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40241-ANRRBS22240
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-Flag МеткаVG40241-CFRBS20190
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-His МеткаVG40241-CHRBS20190
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-Myc МеткаVG40241-CMRBS20190
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-HA МеткаVG40241-CYRBS20190
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid (Codon Optimized)VG40241-GRBS6500
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-Flag МеткаVG40241-NFRBS20190
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-His МеткаVG40241-NHRBS20190
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-Myc МеткаVG40241-NMRBS20190
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-HA МеткаVG40241-NYRBS20190
HIV-1 (group M, subtype A, strain 92UG037.1) gag natural ORF mammalian expression plasmidVG40241-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40241-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».