After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ITGB1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002211.3
Размер кДНК:2397bp
Описание кДНК:Full length Clone DNA of Homo sapiens integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), transcript variant 1A with C terminal Myc tag.
Синоним гена:CD29, FNRB, MDF2, VLAB, GPIIA, MSK12, VLA-BETA
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:pCMV3-ITGB1-Myc
Участок рестрикции:KpnI + XbaI (6kb + 2.44kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 459T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGB1 Gene Plasmid Map
HHuman Integrin beta1 transcript variant 1A ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10587-ACGRBS16760
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10587-ACRRBS16760
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10587-ANGRBS16760
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10587-ANRRBS16760
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10587-CFRBS14710
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10587-CHRBS14710
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10587-CMRBS14710
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10587-CYRBS14710
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин клон кДНК в вектор клонированияHG10587-MRBS5130
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10587-NFRBS14710
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10587-NHRBS14710
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10587-NMRBS14710
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10587-NYRBS14710
Человек ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Джин ORF экспрессии кДНК клона плазмидыHG10587-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10587-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • HHuman Integrin beta1 transcript variant 1A ORF mammalian expression plasmid, C-Myc tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».