Быстрый заказ

Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HHIP Информация о продукте «Клон cDNA»
Размер кДНК:2103bp
Описание кДНК:Full length Clone DNA of Homo sapiens hedgehog interacting protein with His tag.
Синоним гена:HIP, HHIP
Участок рестрикции:KpnI + XhoI (5.5kb + 2.13kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref.ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human HHIP Gene Plasmid Map
Human HHIP Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13798-ACGRBS16760
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13798-ACRRBS16760
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13798-CFRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13798-CHRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13798-CMRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13798-CYRBS14710
Человек HHIP Джин клон кДНК в вектор клонированияHG13798-GRBS5130
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13798-NFRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13798-NHRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13798-NMRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13798-NYRBS14710
Человек HHIP Джин ORF экспрессии кДНК клона плазмидыHG13798-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13798-G-H
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Human HHIP Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.